View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10694_low_10 (Length: 254)
Name: NF10694_low_10
Description: NF10694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10694_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 104 - 232
Target Start/End: Original strand, 50632290 - 50632421
Alignment:
| Q |
104 |
cacacaagttgatgttttcttcattttctctttcaactagaattcaagagt---gtgtttgtttttgttgaatgaatgaatgaccaatgttttcacttgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50632290 |
cacacaagttgatgttttcttcattttctctttcaactacaattcaagagtagtgtgtttgtttttgtggaatgaatgaatgaccaatgttttcacttgg |
50632389 |
T |
|
| Q |
201 |
ctgctatttaaggtagtttggtcggtgagcta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
50632390 |
ctgctatttaaggtagtttggtcggtgagcta |
50632421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 50632187 - 50632230
Alignment:
| Q |
1 |
agggtgtctgtttgcatatttggtccaccaaatcatccttcatt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50632187 |
agggtgtctgtttgcatatttggtccaccaaatcatccttcatt |
50632230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University