View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10694_low_13 (Length: 235)
Name: NF10694_low_13
Description: NF10694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10694_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 95998 - 96200
Alignment:
| Q |
18 |
gtttctaatttgaaaattccaggagatgcaagacatgagggactgctatgataccttactttccgcagcggccgcaaccgccagtagtgcttatggtatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
95998 |
gtttctaatttgaaaattccaggagatgcaagacatgagggactgctatgataccttactttccgcagcggccgcaaccgccagtagtgcttatggtatt |
96097 |
T |
 |
| Q |
118 |
tt-tctattcatttagaaatgattaccgcaactatgtgaattatgtaatgatcatgtagtaattatacagaattcgctgagtcgttgcgggacatgggtt |
216 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
96098 |
ttttctattcatttagaaatgattaccgcaactatgtgaattatgtaatgatcatgtagtaattatacagaattcgctgagtcgttgcgggacatgggtt |
96197 |
T |
 |
| Q |
217 |
ctt |
219 |
Q |
| |
|
||| |
|
|
| T |
96198 |
ctt |
96200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University