View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10694_low_17 (Length: 206)
Name: NF10694_low_17
Description: NF10694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10694_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 30532464 - 30532294
Alignment:
| Q |
17 |
aggggggtgtgaatagtgagaaagagtgaacatagtttaatggctttgagattcttttgtcaacatagaatcttgtagaagatgaaaaacatggcggtgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
30532464 |
aggggggtgtgaatagtgagaaagagtgaacatagtttaatggctttgagattcttttgtcaatatagaatcttgtaaaagatgaaaaacatggcagtgt |
30532365 |
T |
|
| Q |
117 |
tgaagctgcaacagttgtgaacattttaaggattttgttggagggactgaacttgaacaagaactataacta |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30532364 |
tgaagctgcaacagttgtgaacattttaaggattttgttggaggg-ctgaacttgaacaagaactataacta |
30532294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University