View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10694_low_5 (Length: 325)
Name: NF10694_low_5
Description: NF10694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10694_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 138 - 318
Target Start/End: Original strand, 48303130 - 48303310
Alignment:
| Q |
138 |
accgcttatcagaagcacattctcatcttcaacctgaaccttgatgtcaccagatttcaaccctggcatgtccaccacgaacacgtatgagtttggatac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48303130 |
accgcttatcagaagcacattctcatcttcaacctgaaccttgatgtcaccagatttcaaccctggcatgtccaccacgaacacgtatgagtttggatac |
48303229 |
T |
 |
| Q |
238 |
tctttcacgtctgctggtgttgcagccattgcttttgcgtcgcgaacgtaggttcgtgttggtgcgtttagattcttctct |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48303230 |
tctttcacgtctgctggtgttgcagccattgcttttgcgtcgcgaacgtaggttcgtgttggtgcgtttagattcttctct |
48303310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 48303009 - 48303073
Alignment:
| Q |
17 |
cagaaacaccaccttcaacatcagcattctctggtaacacaaatttcctcataaacttaccaacc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48303009 |
cagaaacaccaccttcaacatcagcattctctggtaacacaaatttcctcataaacttaccaacc |
48303073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 139 - 227
Target Start/End: Original strand, 3744930 - 3745018
Alignment:
| Q |
139 |
ccgcttatcagaagcacattctcatcttcaacctgaaccttgatgtcaccagatttcaaccctggcatgtccaccacgaacacgtatga |
227 |
Q |
| |
|
|||||||||| |||||| || |||||||| ||||||||||| || || ||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
3744930 |
ccgcttatcacaagcacgttatcatcttccacctgaaccttaatatccccagatttcaatcctggcatgtcaatcacgaacacgtatga |
3745018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 39 - 81
Target Start/End: Original strand, 3744827 - 3744869
Alignment:
| Q |
39 |
agcattctctggtaacacaaatttcctcataaacttaccaacc |
81 |
Q |
| |
|
||||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
3744827 |
agcattctcaggaagcacaaatttcctcataaacttaccaacc |
3744869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 143 - 251
Target Start/End: Complemental strand, 10462246 - 10462138
Alignment:
| Q |
143 |
ttatcagaagcacattctcatcttcaacctgaaccttgatgtcaccagatttcaaccctggcatgtccaccacgaacacgtatgagtttggatactcttt |
242 |
Q |
| |
|
|||||| || ||| || ||||||||||||| ||||||||| |||||||||||||| || |||| ||||| | |||| ||| |||||||| | || || || |
|
|
| T |
10462246 |
ttatcacaaccactttatcatcttcaacctcaaccttgatatcaccagatttcaatcccggcaagtccatctcgaatacgaatgagttttggtattcctt |
10462147 |
T |
 |
| Q |
243 |
cacgtctgc |
251 |
Q |
| |
|
||||||||| |
|
|
| T |
10462146 |
cacgtctgc |
10462138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 143 - 251
Target Start/End: Original strand, 10539878 - 10539986
Alignment:
| Q |
143 |
ttatcagaagcacattctcatcttcaacctgaaccttgatgtcaccagatttcaaccctggcatgtccaccacgaacacgtatgagtttggatactcttt |
242 |
Q |
| |
|
|||||| || |||||| ||||||||||||| ||||||||| ||| ||||||||| || |||| || | |||||||||| |||||| |||| || || |
|
|
| T |
10539878 |
ttatcacaaccacattatcatcttcaacctcaaccttgatatcatcagatttcattcccagcatatctgtctcgaacacgtacgagttttgatattcctt |
10539977 |
T |
 |
| Q |
243 |
cacgtctgc |
251 |
Q |
| |
|
||||||||| |
|
|
| T |
10539978 |
cacgtctgc |
10539986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University