View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10694_low_9 (Length: 256)
Name: NF10694_low_9
Description: NF10694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10694_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 2 - 238
Target Start/End: Original strand, 38983313 - 38983549
Alignment:
| Q |
2 |
gttttggaattttttccagagttcttgtggatgtggacctatctgagcagctctttgaaactgttgttgtggaaagggaagatcacgctctgtccattga |
101 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38983313 |
gttttgggattttttccagagttcttgtggatgtggacctatctgagcagctctttgaaactgttgttgtggaaagggaagatcatgctctgtccattga |
38983412 |
T |
 |
| Q |
102 |
tgtcttttatgataagcatccttccttctgtgctaattacaaaaccttgggacataacttaatcacacaaacaatactgaagtgcctgctagaatgaaaa |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38983413 |
tgtcttttatgagaagcatccttccttctgtgctaattgcaaaaccttaggacatagcttaatcacacaaacaatactgaagtgcctgctagaatgaaaa |
38983512 |
T |
 |
| Q |
202 |
ttaggactgatttgaatggaaagaaacatgcttctaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38983513 |
ctaggactgatttgaatggaaagaaacatgcttctaa |
38983549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University