View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10695_high_3 (Length: 271)
Name: NF10695_high_3
Description: NF10695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10695_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 34 - 264
Target Start/End: Complemental strand, 8785266 - 8785032
Alignment:
| Q |
34 |
cactcgttaacattttccattaaaaattcacatacataattgaaggtgttagggtttgaacctaagcatagcgtc--atctaacaactttaacatttttt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||| ||| ||||| |||||||||||||||||||||| |
|
|
| T |
8785266 |
cactcgttaacattttccattaaaaattcacacacataattgaaggtgttaggattcgaacctaatcatggcgtctcatctaacaactttaacatttttc |
8785167 |
T |
|
| Q |
132 |
gccatttgaattagtatttatagacttttcagtatacaatctttc--nnnnnnnngtatacaatctatagagcttatattttactttttgtgagtgaaaa |
229 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8785166 |
gccatttgaattaggatttatagacttttcagtatacaatctttcaataaaaaatatatacaatctatagagcttagattttactttttgtgagtgaaaa |
8785067 |
T |
|
| Q |
230 |
tatatgttttagtttttattatttctttcatctca |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8785066 |
tatatgttttagtttttattatttctttcatctca |
8785032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University