View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10695_low_12 (Length: 239)
Name: NF10695_low_12
Description: NF10695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10695_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 2420435 - 2420212
Alignment:
| Q |
1 |
gttatcccaaagattggtcaagagaaaatgacacttaacgtagaacactaaagaaagcaacatggaaagcctttctttatgcgacttctgttcataaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2420435 |
gttatcccaaagattggtcaagagaaaatgacacttaacgtagaacactaaagaaagcaagatgaaaagcctttctttatgctacttctgttcataaccc |
2420336 |
T |
 |
| Q |
101 |
ttcgccaatatgcaagatccataaatatagatta-ggatctcgaatattcaatcgtacgtcgnnnnnnnnngttagttccaaaaggtatcattaattctc |
199 |
Q |
| |
|
|| ||||||||||||||||||| | ||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2420335 |
tttgccaatatgcaagatccatgactatagataagggatctcgaatattcaatcgtacgtcgtttttttttgttagttccaaaaggtatcattaattctc |
2420236 |
T |
 |
| Q |
200 |
ttcattattcatgcatccacattc |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2420235 |
ttcattattcatgcatccacattc |
2420212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University