View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10695_low_5 (Length: 391)
Name: NF10695_low_5
Description: NF10695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10695_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 30 - 348
Target Start/End: Complemental strand, 24946921 - 24946600
Alignment:
| Q |
30 |
ttgtaatttgtgcaaactgggcatgtcaataaagataagaatcagaaaccaaaatgtacaaaatttaagatgtcatgtttgaaagatttttt--cgaata |
127 |
Q |
| |
|
|||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
24946921 |
ttgtaattagtacaaacagggcatgtcaataaagataagaatcagaaaccaaaatgtacaaaatttaagatgtcatgtttgaaagattttttttcaaata |
24946822 |
T |
|
| Q |
128 |
gactatattaaaacacttgatagttatcgacctttggtcttttttcctaatttgacttttcatccatattcgaatgaccctattcccatcagaacttttt |
227 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| ||||| || |
|
|
| T |
24946821 |
gactatattaaaacacttgttagtaatcgacctttggtcttttttcctaatttgacttttcattcatatttgaatggccctattcccatcataacttgtt |
24946722 |
T |
|
| Q |
228 |
tcaaa-ccctggtttctgtctttgtcagtgtattcaaaattcattaatcgtgaatttcttggactacagtcttttcagtggttatctgaatatgaattgg |
326 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
24946721 |
tcaaaaccctggtttctgtctctgtcagtgtattcaaaattcattaatcgtgaatttcttggactacagtcttttcagtggttatctgaatattaatcgg |
24946622 |
T |
|
| Q |
327 |
aattgaatgttctgatttgaaa |
348 |
Q |
| |
|
||||| |||| ||||||||||| |
|
|
| T |
24946621 |
aattggatgtcctgatttgaaa |
24946600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University