View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10695_low_7 (Length: 317)
Name: NF10695_low_7
Description: NF10695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10695_low_7 |
 | |
|
| [»] scaffold0459 (1 HSPs) |
| | |
|
| [»] scaffold0366 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0459 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 5350 - 5058
Alignment:
| Q |
18 |
agtttcaatatatcctacaaagtatgctatgcttaattttatcannnnnnnnatttgctttgtctgcagtcacgatttcacgctcacgaagtcaacacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5350 |
agtttcaatatatcctacaaagtatgctatgcttaattttatcattttttttatttgctttgtctgcagtcacgatttcacgctcacgaagtcaacacat |
5251 |
T |
|
| Q |
118 |
cggtagccattaaatcgagatcgcacgttgcagatttcaagctcgatattttagagtgnnnnnnnntcaaaacctgcttgctttctacaccgttcgaacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5250 |
cggtagccattaaatcgagatcgcacgttgcagatttcaagctcgatattttagagtgaaaaaaaatcaaaacctgcttgctttctacaccgttcgaacc |
5151 |
T |
|
| Q |
218 |
cgatccaaggactaccgatgtgttgacttcatgaatgtgtgggattgtgattgcatgcaatccgaagccttttcaatatgttatttcatctca |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5150 |
cgatccaaggactaccgatgtgttgacttcatgaatgtgtgggattgtgattgcatgcaatccgaagccttttcaatatgttatttcatctca |
5058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 5350 - 5058
Alignment:
| Q |
18 |
agtttcaatatatcctacaaagtatgctatgcttaattttatcannnnnnnnatttgctttgtctgcagtcacgatttcacgctcacgaagtcaacacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5350 |
agtttcaatatatcctacaaagtatgctatgcttaattttatcattttttttatttgctttgtctgcagtcacgatttcacgctcacgaagtcaacacat |
5251 |
T |
|
| Q |
118 |
cggtagccattaaatcgagatcgcacgttgcagatttcaagctcgatattttagagtgnnnnnnnntcaaaacctgcttgctttctacaccgttcgaacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5250 |
cggtagccattaaatcgagatcgcacgttgcagatttcaagctcgatattttagagtgaaaaaaaatcaaaacctgcttgctttctacaccgttcgaacc |
5151 |
T |
|
| Q |
218 |
cgatccaaggactaccgatgtgttgacttcatgaatgtgtgggattgtgattgcatgcaatccgaagccttttcaatatgttatttcatctca |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5150 |
cgatccaaggactaccgatgtgttgacttcatgaatgtgtgggattgtgattgcatgcaatccgaagccttttcaatatgttatttcatctca |
5058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University