View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10696_low_1 (Length: 345)
Name: NF10696_low_1
Description: NF10696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10696_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 206 - 330
Target Start/End: Complemental strand, 31037151 - 31037027
Alignment:
| Q |
206 |
gtatagttatctttaagaaggaagaaaatagagctgagagagaatgttcaaaaaggaatagtaccttttccttcgtctacaaactacatcagaatgagaa |
305 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31037151 |
gtattgttatctttaagaaggaagaaaatagagctgagagagaatgttcaaaaaggaatagtaccttttccttcgtctacaaactacatcagaatgagaa |
31037052 |
T |
 |
| Q |
306 |
tgtacctgtaatatactatgttttc |
330 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31037051 |
tgtacctgtaatatactatgttttc |
31037027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 39 - 91
Target Start/End: Complemental strand, 33537061 - 33537009
Alignment:
| Q |
39 |
ataagaaccaacagctgctcaaatttgagtgacaaaagctatacattcacaaa |
91 |
Q |
| |
|
|||||||||||||||| ||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
33537061 |
ataagaaccaacagcttctccaatttgaatgacaaaagctttacattcacaaa |
33537009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University