View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10696_low_6 (Length: 243)
Name: NF10696_low_6
Description: NF10696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10696_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 234
Target Start/End: Original strand, 34058174 - 34058391
Alignment:
| Q |
15 |
aaaaacaacctttgagggatcaattaacagagactataataacacatgttaataaaaatgcaaactttattgataaattagattaatgaagcnnnnnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34058174 |
aaaaacaacctttgagggatcaattaacagagactataataacacatgttaataaaaatgcaaactttattgataaattagattaatgaagcaaaaaaaa |
34058273 |
T |
 |
| Q |
115 |
nngaaatgggtcggtaaaagaaagatgaaagttgaagaaattacaggaatgaagtgatgggtgtttcttgagctggaactgagagcttgagctgcttcaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34058274 |
--gaaatgggtcggtaaaagaaagatgaaaattgaagaaattacaggaatgaagtgatgggtgtttcttgagctggaactgagagcttgagctgcttcaa |
34058371 |
T |
 |
| Q |
215 |
tggcgtcttggtcttcatct |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34058372 |
tggcgtcttggtcttcatct |
34058391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University