View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10697_low_4 (Length: 326)
Name: NF10697_low_4
Description: NF10697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10697_low_4 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 45 - 321
Target Start/End: Complemental strand, 6829047 - 6828772
Alignment:
| Q |
45 |
cagattatctaaaattattttgaaataaaagcaatatagttggattctagattacacagcacaaactaacaccgtgtcaatgatgtaatgaaattatttt |
144 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6829047 |
cagattatccaaaattattttgaaataaaagcaatataattggattctagattacacagcacaaactaacaccgtgtcaatgatgtcatgaaattatttt |
6828948 |
T |
|
| Q |
145 |
gacacatttgatataaaggtgtgattttctattataccagaactcatgtgacccttatcctgtgaaatatcattgctactcaatgaaactttactttgtg |
244 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
6828947 |
gacacatttgatataagggtgtgattttctattataccagaactcatgtga-ccttatcctgtgaaatatcattgctacttaatggaactttactttgtg |
6828849 |
T |
|
| Q |
245 |
ggctgaagagaaatgttttgatgctgcaactatggaggccttaggtccactagttgcagtatctttggtacttgtct |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6828848 |
ggctgaagagaaatgttttgatgctgcaactatggaggctttaggtccactagttgcagtatctttggtacttgtct |
6828772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 6829102 - 6829061
Alignment:
| Q |
7 |
actagttgactcaattagtggttaacaagtgtgaaaatcaga |
48 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
6829102 |
actagttgattcaattactggttaacaagtgtgaaaatcaga |
6829061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 245 - 295
Target Start/End: Complemental strand, 21737624 - 21737574
Alignment:
| Q |
245 |
ggctgaagagaaatgttttgatgctgcaactatggaggccttaggtccact |
295 |
Q |
| |
|
||||||||||| ||| |||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
21737624 |
ggctgaagagagatgctttgatcctgcaaccatggaggctttaggtccact |
21737574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 237 - 278
Target Start/End: Original strand, 43064 - 43105
Alignment:
| Q |
237 |
actttgtgggctgaagagaaatgttttgatgctgcaactatg |
278 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43064 |
actttgtgggctgaagagaaatgctttgatgctgcaactatg |
43105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University