View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10697_low_9 (Length: 210)
Name: NF10697_low_9
Description: NF10697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10697_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 38628374 - 38628192
Alignment:
| Q |
15 |
aagaatatatgcctcatcatgagtatatatataggttggaaaatatatgaaggggaggaggtgagagtaggtcttactttggaaagaaaa-cgtgtttgg |
113 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
38628374 |
aagaatatatgcctcat---gagtatatatataggttggaaaatatatgaaggggaggaggtgagagtaggtcttactttggaaacaaaaacgtgtttgg |
38628278 |
T |
|
| Q |
114 |
ctgtagccttcaatgttaaataaaacttgaagtaatctacttttgaacacttcttcttgctcagtctggatgctatgcctatgctt |
199 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38628277 |
ctgtagccttcaatgttaaacaaaacttgaagtaatctacttttgaacaattcttcttgctcagtctggatgctatgcctatgctt |
38628192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 62 - 170
Target Start/End: Original strand, 38698003 - 38698112
Alignment:
| Q |
62 |
tgaaggggaggaggtgagagtaggtcttactttggaaagaaaa-cgtgtttggctgtagccttcaatgttaaataaaacttgaagtaatctacttttgaa |
160 |
Q |
| |
|
||||||||| ||| ||||||||||| |||||||| ||| |||| |||||||||||| |||||||||| ||| | | || |||||| |||| ||||||||| |
|
|
| T |
38698003 |
tgaaggggaagagatgagagtaggtattactttgtaaacaaaaacgtgtttggctgcagccttcaattttagacagaagttgaagcaatccacttttgaa |
38698102 |
T |
|
| Q |
161 |
cacttcttct |
170 |
Q |
| |
|
| |||||||| |
|
|
| T |
38698103 |
ctcttcttct |
38698112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University