View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_high_23 (Length: 250)
Name: NF10698_high_23
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 48677479 - 48677726
Alignment:
| Q |
1 |
tttctcgttgcagagacctctctttcaactctttgacaggtgacctccctcagactatgagctcactaacaggcataaccaccatgtagatatccaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48677479 |
tttctcgttgcagagacctctctttcaattctttgacaggtgacctccctcagactatgagctcactaacaggcataaccaccatgtagatatccaaaaa |
48677578 |
T |
|
| Q |
101 |
at--ttatgttttgtgctaatattttacatgttattgatttcattctaagttgccatatttacatttgtgtaggtatctgcaaaacaaccaatttacagg |
198 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48677579 |
aaaattatgttttgtgctaatattttacatgttattgatttcattctaagttgccatgtttacatttgtgtaggtatctgcaaaacaaccaatttacagg |
48677678 |
T |
|
| Q |
199 |
cgctattgatattcttgctgatctgcctctgaatagtctctgcttctc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
48677679 |
cgctattgatattcttgctgatctgcctctgaatagtctgtgcgtctc |
48677726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 131 - 228
Target Start/End: Complemental strand, 8535268 - 8535171
Alignment:
| Q |
131 |
tattgatttcattctaagttgccatatttacatttgtgtaggtatctgcaaaacaaccaatttacaggcgctattgatattcttgctgatctgcctct |
228 |
Q |
| |
|
|||||||| |||||||||||| | ||||| | |||||||| |||| |||||||||||||||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
8535268 |
tattgattgcattctaagttgactcgtttacgtgtgtgtaggaatctacaaaacaaccaatttacaggaaccattgatatccttgctgatctgcctct |
8535171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 88
Target Start/End: Complemental strand, 8535377 - 8535310
Alignment:
| Q |
21 |
tctttcaactctttgacaggtgacctccctcagactatgagctcactaacaggcataaccaccatgta |
88 |
Q |
| |
|
|||||||| |||||||| || || |||||||||||||||| |||||| || ||||| |||||||||| |
|
|
| T |
8535377 |
tctttcaattctttgaccggagatctccctcagactatgaactcactttcaagcatatccaccatgta |
8535310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University