View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_15 (Length: 354)
Name: NF10698_low_15
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 88 - 347
Target Start/End: Original strand, 48061018 - 48061277
Alignment:
| Q |
88 |
aaattgatgaggaaattttgggtaaaaatgggtttttgctggttcaagcattggttgattctgaagggagatttttagatgtttcatctgggtggccaaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48061018 |
aaattgatgaggaaattttgggtaaaaatgggtttttgctggttcaagcattggttgattctgaagggagatttttagatgtttcatctgggtggccaaa |
48061117 |
T |
|
| Q |
188 |
ttcaatgaaacctgaaacgattttgcatgagagtaagctttaccatggggttgtggaatcaagggaattgttgcaagggccatcttataagctaagtgat |
287 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48061118 |
ttcgatgaaacctgaaacgattttgcatgagagtaagctttaccatggggttgtggaatcaagggaattgttgcaaggaccatcttataagctaagtgat |
48061217 |
T |
|
| Q |
288 |
ggaagtttgattcctcagtatgttttgggagattcatgttttccacttttgcctttgctt |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48061218 |
ggaagtttgattcctcagtatgttttgggagattcatgttttccacttttgccttggctt |
48061277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University