View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_16 (Length: 345)
Name: NF10698_low_16
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 332
Target Start/End: Original strand, 5940476 - 5940793
Alignment:
| Q |
18 |
gcattaaattcattggactacctctgtaaattccgttcttgtttgacccctaatgtcctataccatatactaggttagttttatttttcaattatatcat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5940476 |
gcattaaattcattggactacctctgtaaattccgttcttggttgacccctaatgtcctataccacatactaggttagttttatttttcaattatatcat |
5940575 |
T |
|
| Q |
118 |
aagataccaattattagatcctgttttttaaagctcaataattttacacctaaaaaatgaccacactaggttagtccactcatattttaactttgcatat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5940576 |
aagataccaattattagatcctgttttttaaagctcaataattttacacctaaaaaatgaccacactaggttagtccactcatattttaactttgcatat |
5940675 |
T |
|
| Q |
218 |
agacatcaaatcatgnnnnnnnnnnnnnnncccttcaaataatcgtgtttgaggcactttgaacatctctttcagctgatat----atattggttcgtcg |
313 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
5940676 |
agacatcaaatcatgttttactttttttct-tcttcaagtaatcgtatttgaggcactttgaacatctctttcaactgatattaaaatattggttcgtcg |
5940774 |
T |
|
| Q |
314 |
tattgtgggattaatctct |
332 |
Q |
| |
|
||||| |||| |||||||| |
|
|
| T |
5940775 |
tattgcgggactaatctct |
5940793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University