View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_23 (Length: 302)
Name: NF10698_low_23
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 6698278 - 6698577
Alignment:
| Q |
1 |
gattcttcaacgatgttatgcccttagaagtgtctcttcaacatggtggataggtggagaaaatgtttcagcttttgcatttgcaccaacaccaacatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6698278 |
gattcttcaacgatgttatgcccttagaagtgtctcttcaacatggcggataggtggagaaaatgtttcagcttttgcatttgcaccaacaccaacatga |
6698377 |
T |
 |
| Q |
101 |
ttacttggataacaagctttacaaagctcattatacctatttgcatcaaagttgtatgccttcataagacgctcttgtttagccatgaaacgacgatgga |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6698378 |
ttacttggataacaagctttgcaaagctcattatacctatttgcatcaaagttgtatgtcttcataagacgctcttgtttagacatgaaacgacgatgga |
6698477 |
T |
 |
| Q |
201 |
aatagccttgaaatgttggctcagttgaagtccttatgaagaataggtatgcaaaagcaaagtgcagggaagtaacaaagaaacatattggttccataac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6698478 |
aatagccttgaaatgttggctcagttgaagtccttatgaagaataggtatgcaaaagcaaagtgcagggaagtaacaaagaaacatactggttccataac |
6698577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University