View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_29 (Length: 265)
Name: NF10698_low_29
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 2166086 - 2165856
Alignment:
| Q |
19 |
gatattccaatagttgaagtgagatttgagcatataaatgttgaagcaaaagtttatgttggaggcagagctttgccttcattgctcaacttctatgcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2166086 |
gatattccaatagttgaagtgagatttgagcatataaatgttgaagcacaagtttatgttggaggaagagctttgccttcattgctcaacttctatgcta |
2165987 |
T |
 |
| Q |
119 |
atgtcttagaggtgattaatcaacatgccactttatgctttctacccttttcttggatttatattatctttgattattatttataaaatgatctctttct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2165986 |
atgtcttagaggtgattaatcaacatgccactttatgctttctacccttttcttggatttatattatctttgattattatttataaaatgatctctttct |
2165887 |
T |
 |
| Q |
219 |
ttttgttaagggattcttaaattatcttcat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2165886 |
ttttgttaagggattcttaaattatcttcat |
2165856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 23 - 101
Target Start/End: Complemental strand, 2153674 - 2153596
Alignment:
| Q |
23 |
ttccaatagttgaagtgagatttgagcatataaatgttgaagcaaaagtttatgttggaggcagagctttgccttcatt |
101 |
Q |
| |
|
|||||| | ||||||| ||||||||| |||||||||| |||||| |||||||||||||| | ||||| |||||| |||| |
|
|
| T |
2153674 |
ttccaacaattgaagttagatttgaggatataaatgtggaagcacaagtttatgttggaaggagagcattgcctacatt |
2153596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University