View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_35 (Length: 250)
Name: NF10698_low_35
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 50101983 - 50102221
Alignment:
| Q |
1 |
ttacaaagtcgtttgattcatgtagctaattccaccagtgggattagacttggttgctgttgttgttgtaacaattaaatacattgtcgattcagatttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50101983 |
ttacaaagtcgtttgattcatgtagctaaacccaccagtgggattagacttggttgctgttgttgttgtaacaattaaatacattgtcgattcagattta |
50102082 |
T |
|
| Q |
101 |
gatgagcttgatatgattaaagactatcaaaaatatatgttttatgattgctctgtctgtagtaaatggcctgggaaaaagcactggagggtaaccatta |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50102083 |
gatgagcttgatatgattaaagaccatcaaaaatatatgttttatgattgctctgtctgtagtaaatggcctgggaaaaagcactggagggtaaccatta |
50102182 |
T |
|
| Q |
201 |
ctatgttgatctaattgtttcttgggttatgtttttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50102183 |
ctatgttgatctaattgtttcttgggttatgtttttcat |
50102221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 37 - 70
Target Start/End: Original strand, 26299324 - 26299357
Alignment:
| Q |
37 |
agtgggattagacttggttgctgttgttgttgta |
70 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
26299324 |
agtgggataagacttggttgctgttgttgttgta |
26299357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University