View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_36 (Length: 250)
Name: NF10698_low_36
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 2875689 - 2875928
Alignment:
| Q |
1 |
tatatgaatttctatacaacaggcagggttaggttatgctagatcacaattgataagcagcttattgtgctagtttctcagacaaaaaatcttattgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2875689 |
tatatgaatttctatacaacaggcagggttaggttatgctagatcacaattgataagcagcttattgtgctagtttctcagacaaaaaatcttattgcaa |
2875788 |
T |
|
| Q |
101 |
atgaatcagtgttgttgtaagagataaaagtcactatactatcttggcattcttttaatcattacaactgtgtttaacaagaaaacattgatcaattatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2875789 |
atgaatcagtgttgttgtaagagataaaagtcactatactatcttggcattcttttaatcattacaactgtgtttaacaagaaaacattgatcaattatt |
2875888 |
T |
|
| Q |
201 |
ttgatgcatagtttgaagttatttgttggctctgtctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2875889 |
ttgatgcatagtttgaagttatttgttggctctgtctctg |
2875928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 117 - 185
Target Start/End: Original strand, 2858325 - 2858393
Alignment:
| Q |
117 |
gtaagagataaaagtcactatactatcttggcattcttttaatcattacaactgtgtttaacaagaaaa |
185 |
Q |
| |
|
||||||||||||| ||||| | ||||||| |||||||||||| ||||||| |||||||||| |||||| |
|
|
| T |
2858325 |
gtaagagataaaattcactgttctatcttaccattcttttaattattacaattgtgtttaactagaaaa |
2858393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 232
Target Start/End: Original strand, 2847011 - 2847046
Alignment:
| Q |
197 |
tattttgatgcatagtttgaagttatttgttggctc |
232 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2847011 |
tattttgatgcatagtttgaagttaattgttggctc |
2847046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 232
Target Start/End: Original strand, 2858848 - 2858883
Alignment:
| Q |
197 |
tattttgatgcatagtttgaagttatttgttggctc |
232 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2858848 |
tattttgatgcatagtttgaagttaattgttggctc |
2858883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University