View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10698_low_42 (Length: 248)

Name: NF10698_low_42
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10698_low_42
NF10698_low_42
[»] chr4 (1 HSPs)
chr4 (20-110)||(54088374-54088464)


Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 20 - 110
Target Start/End: Complemental strand, 54088464 - 54088374
Alignment:
20 ctgaccctgcacgagatcctgcatgggagctggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga 110  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54088464 ctgaccctgcacgagatcctgcatgggagccggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga 54088374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University