View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_42 (Length: 248)
Name: NF10698_low_42
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 20 - 110
Target Start/End: Complemental strand, 54088464 - 54088374
Alignment:
| Q |
20 |
ctgaccctgcacgagatcctgcatgggagctggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088464 |
ctgaccctgcacgagatcctgcatgggagccggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga |
54088374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University