View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_44 (Length: 246)
Name: NF10698_low_44
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 47231899 - 47231675
Alignment:
| Q |
1 |
taggctgggtcaacgttttcaggcagtgagtggctgttattcagagagaatctttcttttgatcttaattacggagtactaaactgtctgtagctttggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47231899 |
taggctgggtcaacgttttcaggcagtg----gctgttattcagagagaatctttcttttgatcttaattacggagtactaaactgtctgtagctttggg |
47231804 |
T |
 |
| Q |
101 |
acacattctttgacattgctcactgaaaaaagaaactcgtacattcatttttaattgtaaaaggctacatttggattggttttatatttgtgtcctctgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47231803 |
acacattctttgacattgctcactgaaaaaagaaactcgtacattcatttttaattgtaaaaggttacatttggattggttttatatttgtgtcctctgt |
47231704 |
T |
 |
| Q |
201 |
tatgtttagtcttgtgtgagggaatcatt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47231703 |
tatgtttagtcttgtgtgagggaatcatt |
47231675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University