View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_45 (Length: 245)
Name: NF10698_low_45
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 11193568 - 11193339
Alignment:
| Q |
1 |
atgagcatccacaaatctgataatgcaacaaagagatttaaacattttcttattaattaggataggataaaatattttattaacgtattgtttgttgatt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11193568 |
atgagcatccacagatctgataatgcaacaaagagatttaaacattttcttattaattaggataggataaaatattatattaacgtattgtttgttgatt |
11193469 |
T |
 |
| Q |
101 |
tatttaactaggtggtggttggttcaattgggtcatgtgtcaatgatccgatgtgaatcttgaacgacttctagtgttgatgaactatgtcgacggagcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
11193468 |
tatttaactaggtggtggttggttcaattgggtcatgtgtcaatgatccgatgtgaatcttgaacgactactagtgttgatgaagtatgtcgacggagcc |
11193369 |
T |
 |
| Q |
201 |
cctcaaacgtgatgttgtatccgatgttat |
230 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
11193368 |
cctcaaacgagatgttgtatccgatgttat |
11193339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University