View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_52 (Length: 239)
Name: NF10698_low_52
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 10 - 193
Target Start/End: Complemental strand, 5846431 - 5846248
Alignment:
| Q |
10 |
tgagatgaacacgacactactaactgcggtctcaaattgttgatttatagataaaaaataataataataggtagagataaaattgaacgactttaatatt |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5846431 |
tgagaagaacacgacactactaactgcggtctcaaattgctgatttatagataaaaagtaataataataggtagagataaaattgaacgactttaatatt |
5846332 |
T |
|
| Q |
110 |
ttataaaattgattacaatatcataagtttctttattcaaattatcaaaatgatgaggtgcagtatggcctttagaggctaaaa |
193 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5846331 |
ttataaaattgattacaatttcataagtttctttattcaaattatcaaaatgatgaggtgcagtatggcctttcgaggctaaaa |
5846248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University