View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10698_low_53 (Length: 239)

Name: NF10698_low_53
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10698_low_53
NF10698_low_53
[»] chr3 (1 HSPs)
chr3 (89-220)||(51993256-51993377)


Alignment Details
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 89 - 220
Target Start/End: Original strand, 51993256 - 51993377
Alignment:
89 ggtttgcactgtcctattttatacatcacgttgaattccattttccgtctcatttccnnnnnnnnnnnnngggcctgcgtgtgttcttttaattacttgg 188  Q
    ||||||||||| |||||||||||||||||||||||||||| || |||||||||||||             ||||||||||||||||||||||||||||||    
51993256 ggtttgcactgccctattttatacatcacgttgaattccaattgccgtctcatttccttt----------gggcctgcgtgtgttcttttaattacttgg 51993345  T
189 gcctcaaagtctggattcatttcttttctcac 220  Q
    ||||||||||||||||||||||||||||||||    
51993346 gcctcaaagtctggattcatttcttttctcac 51993377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University