View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_56 (Length: 233)
Name: NF10698_low_56
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 12945057 - 12944859
Alignment:
| Q |
20 |
ggagctggcgaagatttttgcagcacgcggggtgcacgtggagtcctgttttgatgaggatgggtatcatgctgtggaaatctttgatcgttctaaggca |
119 |
Q |
| |
|
|||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12945057 |
ggagctggcgaagattttggcggcacgtggggtgcacgtggagtcctgttttgatgaggatgggtatcatgctgtggaaatctttgatcgttctaaggca |
12944958 |
T |
|
| Q |
120 |
caagttttgcttgaaaatgttaagaaatttatactctctgctgtttctgttgctcctcaatcctctatgtgacacttt---gtagcatgtgtttttctt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12944957 |
caagttttgcttgaaaatgttaagaaatttatactctctgctgtttctgttgctcctcaatcctctatgtgacactttgtggtagcatgtgtttttctt |
12944859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 14 - 151
Target Start/End: Complemental strand, 12937391 - 12937254
Alignment:
| Q |
14 |
gcaaagggagctggcgaagatttttgcagcacgcggggtgcacgtggagtcctgttttgatgaggatgggtatcatgctgtggaaatctttgatcgttct |
113 |
Q |
| |
|
||||| |||||| | ||||||||| | ||||| ||||||||||||||||| |||| ||||||||||| ||||||||||||| ||||||||| | || |
|
|
| T |
12937391 |
gcaaaaggagctagtgaagattttggaggcacgtggggtgcacgtggagtctgttttttgtgaggatgggtttcatgctgtggaactctttgatcctgct |
12937292 |
T |
|
| Q |
114 |
aaggcacaagttttgcttgaaaatgttaagaaatttat |
151 |
Q |
| |
|
|||||||||| || ||||| | |||||||||||||| |
|
|
| T |
12937291 |
aaggcacaagcattacttgattacgttaagaaatttat |
12937254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University