View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10698_low_56 (Length: 233)

Name: NF10698_low_56
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10698_low_56
NF10698_low_56
[»] chr8 (2 HSPs)
chr8 (20-215)||(12944859-12945057)
chr8 (14-151)||(12937254-12937391)


Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 12945057 - 12944859
Alignment:
20 ggagctggcgaagatttttgcagcacgcggggtgcacgtggagtcctgttttgatgaggatgggtatcatgctgtggaaatctttgatcgttctaaggca 119  Q
    |||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12945057 ggagctggcgaagattttggcggcacgtggggtgcacgtggagtcctgttttgatgaggatgggtatcatgctgtggaaatctttgatcgttctaaggca 12944958  T
120 caagttttgcttgaaaatgttaagaaatttatactctctgctgtttctgttgctcctcaatcctctatgtgacacttt---gtagcatgtgtttttctt 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||    
12944957 caagttttgcttgaaaatgttaagaaatttatactctctgctgtttctgttgctcctcaatcctctatgtgacactttgtggtagcatgtgtttttctt 12944859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 14 - 151
Target Start/End: Complemental strand, 12937391 - 12937254
Alignment:
14 gcaaagggagctggcgaagatttttgcagcacgcggggtgcacgtggagtcctgttttgatgaggatgggtatcatgctgtggaaatctttgatcgttct 113  Q
    ||||| |||||| | ||||||||| |  ||||| |||||||||||||||||   ||||  ||||||||||| ||||||||||||| ||||||||| | ||    
12937391 gcaaaaggagctagtgaagattttggaggcacgtggggtgcacgtggagtctgttttttgtgaggatgggtttcatgctgtggaactctttgatcctgct 12937292  T
114 aaggcacaagttttgcttgaaaatgttaagaaatttat 151  Q
    ||||||||||  || |||||  | ||||||||||||||    
12937291 aaggcacaagcattacttgattacgttaagaaatttat 12937254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University