View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_65 (Length: 221)
Name: NF10698_low_65
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_65 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 20 - 107
Target Start/End: Complemental strand, 32136296 - 32136209
Alignment:
| Q |
20 |
ggttggtcactctctcgtttataggagacacgtcatgtgctttttaatctcttaaacctgtaaccggctgaacaagtcatgaatttat |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32136296 |
ggttggtcactctctcgtttataagagacacgtcatgtgctttttaatctcttaaacctgtaactggctgaacaagtcatgaatttat |
32136209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 141 - 207
Target Start/End: Complemental strand, 32136175 - 32136109
Alignment:
| Q |
141 |
ctcaaaaattgtgttgtgcagcaaatctaaaaacaccttaaatccaattctagcatttccaatctcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32136175 |
ctcaaaaattgtgttgtgcagcaaatctaaaaacaccttaaatccaattctagcatttccaatctcc |
32136109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 30752955 - 30752890
Alignment:
| Q |
40 |
ataggagacacgtcatgtgctttttaatctcttaaacctgtaaccggctgaacaagtcatgaattt |
105 |
Q |
| |
|
||||| |||||||||| | ||||| |||||||| |||| || ||||||||||||||| |||||||| |
|
|
| T |
30752955 |
ataggtgacacgtcatttacttttcaatctcttgaaccggttaccggctgaacaagtaatgaattt |
30752890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 105
Target Start/End: Original strand, 40219429 - 40219494
Alignment:
| Q |
40 |
ataggagacacgtcatgtgctttttaatctcttaaacctgtaaccggctgaacaagtcatgaattt |
105 |
Q |
| |
|
||||| |||||||||| | ||||| |||||||| |||| || ||||||||||||||| |||||||| |
|
|
| T |
40219429 |
ataggtgacacgtcatttacttttcaatctcttgaaccggttaccggctgaacaagtaatgaattt |
40219494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 105
Target Start/End: Original strand, 36299121 - 36299186
Alignment:
| Q |
40 |
ataggagacacgtcatgtgctttttaatctcttaaacctgtaaccggctgaacaagtcatgaattt |
105 |
Q |
| |
|
||||| |||||||||| | ||||| |||||||| |||| || ||||||||||||||| |||||||| |
|
|
| T |
36299121 |
ataggtgacacgtcatttacttttcaatctcttgaaccggttaccggctgaacaagtaatgaattt |
36299186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University