View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_66 (Length: 220)
Name: NF10698_low_66
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 7322559 - 7322748
Alignment:
| Q |
17 |
agaaaaagtaaacatgctttcaaaattatcttacttggaagatagttgatcccgcgacagaaagtttaaatgactgaaatcaatataaaattcactgcaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7322559 |
agaaaaagtaaacatgctttcaaaattatcttacttggaagatagttgatcccgcgatagaaagtttaaatgactgaaatcaatataaaattcactgcaa |
7322658 |
T |
 |
| Q |
117 |
tgcctcacataaactaaaccaattctaggcagtaacctgtaaaacactttcctccctagattctactgagaattctaggcagtcaattct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7322659 |
tgcctcacataaactaaaccaattctaggcagtaacctgtaaaacactttcctccctagattctactgagaattctaggcagtcaattct |
7322748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 102 - 182
Target Start/End: Complemental strand, 7231271 - 7231190
Alignment:
| Q |
102 |
taaaattcactgcaatgcctc-acataaactaaaccaattctaggcagtaacctgtaaaacactttcctccctagattctac |
182 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7231271 |
taaaattcactgttatacctcgacataaactaaaccaattctaggcagtaacctgtaaaacactttcctccctagattctac |
7231190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 186
Target Start/End: Original strand, 25615463 - 25615519
Alignment:
| Q |
128 |
aactaaaccaattctaggcagtaacctgtaaaacactttcctccctagattctactgag |
186 |
Q |
| |
|
|||||||| |||| ||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
25615463 |
aactaaacaaattttaggcagtaacctc--aaacacttttctccctagattctactgag |
25615519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University