View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_77 (Length: 201)
Name: NF10698_low_77
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_77 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 51 - 183
Target Start/End: Original strand, 40039452 - 40039585
Alignment:
| Q |
51 |
agagagagaatatgagattaatcctcacttaatagcatgacatcagtttattannnnnnnnnnnnnaca-aggtatctaacataatatctactatagatt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
40039452 |
agagagagaatatgagattaatcctcacttaatagcttgacatcagtttattgtttttgtttttttacagaggtatctaacataatctctaccatagatt |
40039551 |
T |
 |
| Q |
150 |
acaaggtaattttgggcaaggtgaagcaatggtc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40039552 |
acaaggtaattttgggcaaggtgaagcaatggtc |
40039585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University