View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10698_low_9 (Length: 426)
Name: NF10698_low_9
Description: NF10698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10698_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 409; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 409; E-Value: 0
Query Start/End: Original strand, 1 - 417
Target Start/End: Complemental strand, 6993343 - 6992927
Alignment:
| Q |
1 |
tattggagtctttcaatgcttctgggttcatgctcaatggttctattcctgagtggtttggtgagaagcttggtgcactaaaagagcttgatttaaggtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993343 |
tattggagtctttcaatgcttctgggttcatgctcaatggttctattcctgagtggtttggtgagaagcttggtgcactaaaagagcttgatttaaggtc |
6993244 |
T |
 |
| Q |
101 |
ttgttcaatatctggtgtgattcctggttcacttgggggcatgagaagtttgaagaagttgtttctttcaaggaacaatcttactagtagagtgccttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993243 |
ttgttcaatatctggtgtgattcctggttcacttgggggcatgagaagtttgaagaagttgtttctttcaaggaacaatcttactagtagagtgccttca |
6993144 |
T |
 |
| Q |
201 |
ggtttggggttgttatctaatctttctattctcgatctctctaggaatttgctttcaggatcagtacctgaatctttctctaagctcggtaacattacaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993143 |
ggtttggggttgttatctaatctttctattcttgatctctctaggaatttgctttcaggatcagtacctgaatctttctctaagctcggtaacattacaa |
6993044 |
T |
 |
| Q |
301 |
ggcttgatctttctaataattatttatctggctctattccacctgaactaggtaccctttcaaatcttcaaaatttgaacctttctaacaattctttcac |
400 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993043 |
ggcttgatctttcaaataattatttatctggctctattccacctgaactaggtaccctttcaaatcttcaaaatttgaacctttctaacaattctttcac |
6992944 |
T |
 |
| Q |
401 |
ttcttcgcttccctctc |
417 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6992943 |
ttcttcgcttccctctc |
6992927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University