View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10699_high_10 (Length: 241)
Name: NF10699_high_10
Description: NF10699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10699_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 40585786 - 40585563
Alignment:
| Q |
1 |
ttaattgattaaaattaatggtatatatannnnnnnnnnggaataaaattaatggtatattttcaatagtgaacttatattttcctactctttaaaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40585786 |
ttaattgattaaaattaatggtatatat-ttttttttttggaataaaattaatggtatattttcaatagtgaacttatattttcctactctttaaaattt |
40585688 |
T |
 |
| Q |
101 |
taaatatattatatttatagtttaacacaaatatgcaacaaataattcacttgtttaactggtaacaatatcttaatcacatttgcagaacaagaaaagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40585687 |
taaatatattatatttatagtttaacacaaatatgcaacaaataattcacttgtttaactggtaacaatatcttaatcacattggcagaacaagaaaagc |
40585588 |
T |
 |
| Q |
201 |
acatgtggatgccactatccaaaat |
225 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
40585587 |
acatgtggatgtcactatccaaaat |
40585563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University