View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10699_low_13 (Length: 292)
Name: NF10699_low_13
Description: NF10699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10699_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 9 - 277
Target Start/End: Original strand, 33825268 - 33825536
Alignment:
| Q |
9 |
aggatcagcagcattctttgtgtaggagtggtggtattctctactaatatcttaaggcattaagtgttagaatttttgttgacttccttttgagcaaagt |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33825268 |
aggaacagcagcattctttgtgtaggagtggtggtattctctactaatatcttaaggcattaagtgttagaatttttgttgacttccttttgagcaaagt |
33825367 |
T |
|
| Q |
109 |
taaatttaacctatgtagtagaaagaaagtgcctcaagcattattatctttgtacaaaaatttgtagttaatgactcgatggtcttccatgagtgtgacc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33825368 |
taaatttaacctatgtagtagaaagaaagtgcctcaagcattattatctttgtacaaaaatttgtagttaatgactcgatggtcttccatgagtgtgacc |
33825467 |
T |
|
| Q |
209 |
tatagcttgttaattgttcctgtaggttgtcaagtatcttcactttgtacttctaagcaagttaattat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33825468 |
tatagcttgttaattgttcctgtaggttgtcaagtatcttcactttgtacttctaagcaagttaattat |
33825536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University