View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10699_low_21 (Length: 250)
Name: NF10699_low_21
Description: NF10699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10699_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 24 - 234
Target Start/End: Original strand, 40539416 - 40539626
Alignment:
| Q |
24 |
tattcaactgactaaacagttcagtccgatcaggtttttcttctactaaatcataggtgttttaacttgatttagtttggaatgggttctttatcttttt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40539416 |
tattcaactgactaaacagttcagtccgatcaggtttttcttctactaaatcataggtgttttaacttgatttagtttggaatgggttctttatcttttt |
40539515 |
T |
 |
| Q |
124 |
tatcgtatcaaaataattttctatctttaaaaatgattacaccattgaaccaaattttgttcttagtaatactatactttccttttnnnnnnnntactta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40539516 |
tatcgtatcaaaataattttctatctttaaaaatgattacaccattgaaccaaattttgttcttagtaatactatactttccttttaaaaaaaatactta |
40539615 |
T |
 |
| Q |
224 |
gcatgcctttg |
234 |
Q |
| |
|
||||||||||| |
|
|
| T |
40539616 |
gcatgcctttg |
40539626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 112 - 190
Target Start/End: Original strand, 12692554 - 12692632
Alignment:
| Q |
112 |
ctttatcttttttatcgtatcaaaataattttctatctttaaaaatgattacaccattgaaccaaattttgttcttagt |
190 |
Q |
| |
|
||||||||||||| |||| ||||| || | || |||||||||||||| ||||||||||||||||| ||| |||||||| |
|
|
| T |
12692554 |
ctttatcttttttttcgtgtcaaattagtcttttatctttaaaaatgtttacaccattgaaccaactttcattcttagt |
12692632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University