View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10699_low_28 (Length: 242)
Name: NF10699_low_28
Description: NF10699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10699_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 4322491 - 4322700
Alignment:
| Q |
19 |
ggggaaaaatccatggatcaagaaaaatattcaaaatcaaaatatcgaattaatccttttatttagcagaaaaaatttgattaattcttatcaaacaagt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
4322491 |
ggggaaaaatccatggatcaagaaaaatattcaaaatcagaatatcgaattaatccttttatttagcagaattttttttattaattcttatcaaacaagt |
4322590 |
T |
|
| Q |
119 |
aaaatgtacatgcaacgatgaagctttatttaattaagatatatgaagaaaatatacgtgaccttatatcctctttcaatgtatttgatagcaacaagtt |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4322591 |
aaaatgtacatgcaacgcataagctttatttaattaagatatatgaagaaaatatacttgaccttatatcctctttcaatgtatttgatagcaacaagtt |
4322690 |
T |
|
| Q |
219 |
ctcctgtctt |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
4322691 |
ctcctgtctt |
4322700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University