View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10699_low_29 (Length: 242)
Name: NF10699_low_29
Description: NF10699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10699_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 46700404 - 46700183
Alignment:
| Q |
1 |
tttataacctgatatgattagtctccatggtattcttattgtaacagtagatgatctttcatgttgtgtgtatgcatggaattttccctcactctattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46700404 |
tttataacctgatatgattagtctccatggtattcttattgtaacagtagatgatctttcatgttgtgtgtatgcatggaattttccctcactctattta |
46700305 |
T |
|
| Q |
101 |
annnnnnnnncttcatatctttatgcttgaaaatatgcaggatgattacttgtttcacatctacctctttagtctactctcagttgaggaagcagtctct |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46700304 |
atttttttt--ttcatatctttatgcttgaaaatatgcaggatgattacttgtttcacatctacctctttagtctactctcagttgaggaagcagtctct |
46700207 |
T |
|
| Q |
201 |
attaaagaattgcttggctataca |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46700206 |
attaaagaattgcttggctataca |
46700183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 17 - 87
Target Start/End: Complemental strand, 52894456 - 52894386
Alignment:
| Q |
17 |
attagtctccatggtattcttattgtaacagtagatgatctttcatgttgtgtgtatgcatggaattttcc |
87 |
Q |
| |
|
|||| |||||||||||||| ||||| |||| || |||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
52894456 |
attaatctccatggtattcctattgcaacaatatatgatctttcttgttgtgtgtatgcatgaaattttcc |
52894386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University