View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10699_low_36 (Length: 227)
Name: NF10699_low_36
Description: NF10699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10699_low_36 |
 | |
|
| [»] scaffold0215 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0215 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: scaffold0215
Description:
Target: scaffold0215; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 79 - 214
Target Start/End: Original strand, 22500 - 22635
Alignment:
| Q |
79 |
ccttctttgcccaggtgaaccactcaatccgtgaagctttcgatttccaatcctcaaacatggaattcagttccttcgaaaatctccaaccatctttcac |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22500 |
ccttctttgcccaggtgaaccactcaatccctgaagctttcgaattccaatcctcaaacatggaattcagttccttcgaaaatctccaaccatctttcac |
22599 |
T |
|
| Q |
179 |
ggttcccagaaccctgaaaatcccctttcttacttc |
214 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22600 |
ggttcccagaaccctgaaaataccctttcttacttc |
22635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 82 - 214
Target Start/End: Original strand, 16352684 - 16352816
Alignment:
| Q |
82 |
tctttgcccaggtgaaccactcaatccgtgaagctttcgatttccaatcctcaaacatggaattcagttccttcgaaaatctccaaccatctttcacggt |
181 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16352684 |
tctttgcccaggtgaaccactcaatccctgaagctttcgaattccaatcctcaaacatggaattcagttccttcgaaaatctccaaccatctttcacggt |
16352783 |
T |
|
| Q |
182 |
tcccagaaccctgaaaatcccctttcttacttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
16352784 |
tcccagaaccctgaaaatcccctttcttccttc |
16352816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 79 - 214
Target Start/End: Complemental strand, 18851908 - 18851773
Alignment:
| Q |
79 |
ccttctttgcccaggtgaaccactcaatccgtgaagctttcgatttccaatcctcaaacatggaattcagttccttcgaaaatctccaaccatctttcac |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
18851908 |
ccttctttgcccaggtgaaccactcaatccctgaagctttcgaattccaatcctcaaacatggaattcagttcttttgaaaatctccaaccatctttcac |
18851809 |
T |
|
| Q |
179 |
ggttcccagaaccctgaaaatcccctttcttacttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
18851808 |
ggttcccagaaccctgaaaatcccctttcttacttc |
18851773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University