View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10699_low_37 (Length: 218)
Name: NF10699_low_37
Description: NF10699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10699_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 4031027 - 4031230
Alignment:
| Q |
1 |
ccattttctataattagaacaaaagtttgtacaagtcacaataaaactacggtatctgtccccactcttgattaaatggacaaggttttaaggaaaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4031027 |
ccattttctataattagaacaaaagtttgtacaattcacaataaaactacggtatctgtccccactcttgattaaatggacaaggttttaaggaaaatga |
4031126 |
T |
|
| Q |
101 |
taaatatagcgaaggaaacaatcatgaagcaattgcgaataagtgttattggttgccaatccccaccactgggtgatttcagcaaattccaggactgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4031127 |
taaatatagcgaaggaaacaatcatgaagcaattgcaaataagtgttattggttgccaatccccacgactgggtgatttcagcaaattccaggactgaag |
4031226 |
T |
|
| Q |
201 |
tgat |
204 |
Q |
| |
|
|||| |
|
|
| T |
4031227 |
tgat |
4031230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University