View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10699_low_38 (Length: 210)
Name: NF10699_low_38
Description: NF10699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10699_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 200
Target Start/End: Complemental strand, 34046725 - 34046541
Alignment:
| Q |
17 |
aagatgttgacgacaagataaaattctacc-gtggaagtggtttcttagaagactttcagttattcttgtaattagtatgactgaaagacgaaacctatt |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||| |||||||||| |
|
|
| T |
34046725 |
aagatgctgacgacaagataaaattctacccgtggaagtggtttcttagaagactttcggttattcttgtaatcagtatgagtgaaagatgaaacctatt |
34046626 |
T |
 |
| Q |
116 |
ttatgtaggattacaatagtcggtgagaacaactatgaaaggctgaactacactcatcggtcatcgccatttagtttcacaggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34046625 |
ttatgtaggattacaatagtcggtgagaacaactatgaaaggctgaactacactcattggtcatcgccatttagtttcacaggtt |
34046541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University