View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10699_low_41 (Length: 205)
Name: NF10699_low_41
Description: NF10699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10699_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 55 - 186
Target Start/End: Original strand, 3647205 - 3647337
Alignment:
| Q |
55 |
ggcatgcatgca-gtagaaagaggtagtgatagtgattgattaatttgtgagacctaatatcatggaagctgaagtccaaccaccagttttagatctttc |
153 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3647205 |
ggcatgcatgcaagtagaaagaggtattgatagtgattgattaatttgtaagacctaatatcatggaagctgaagtccaaccaccagttttagatctttc |
3647304 |
T |
 |
| Q |
154 |
tgctggaaaacccttacagtcataggcatcagg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3647305 |
tgctggaaaacccttacagtcataggcatcagg |
3647337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University