View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10699_low_41 (Length: 205)

Name: NF10699_low_41
Description: NF10699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10699_low_41
NF10699_low_41
[»] chr5 (1 HSPs)
chr5 (55-186)||(3647205-3647337)


Alignment Details
Target: chr5 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 55 - 186
Target Start/End: Original strand, 3647205 - 3647337
Alignment:
55 ggcatgcatgca-gtagaaagaggtagtgatagtgattgattaatttgtgagacctaatatcatggaagctgaagtccaaccaccagttttagatctttc 153  Q
    |||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
3647205 ggcatgcatgcaagtagaaagaggtattgatagtgattgattaatttgtaagacctaatatcatggaagctgaagtccaaccaccagttttagatctttc 3647304  T
154 tgctggaaaacccttacagtcataggcatcagg 186  Q
    |||||||||||||||||||||||||||||||||    
3647305 tgctggaaaacccttacagtcataggcatcagg 3647337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University