View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10699_low_44 (Length: 202)
Name: NF10699_low_44
Description: NF10699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10699_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 19 - 162
Target Start/End: Complemental strand, 28613202 - 28613059
Alignment:
| Q |
19 |
cctcaagctttgcaatcatggtttgataacccacaaaaagttcaaaaaaccataggcctgtccaaccaaccccacttagaattagggtttccaaactcat |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28613202 |
cctcaagctttggaatcatggtttgataacccacaaaaagttcaaaaaaccataggcctgtccaaccaaccccacttagaattagggtttccaaactcat |
28613103 |
T |
|
| Q |
119 |
cacaaactctcaccatgtgtaatatctgttttgaaacctttgct |
162 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28613102 |
cacaaactctcaccatgtgtcatatctgttttgaaacctttgct |
28613059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 32 - 130
Target Start/End: Complemental strand, 28604451 - 28604353
Alignment:
| Q |
32 |
aatcatggtttgataacccacaaaaagttcaaaaaaccataggcctgtccaaccaaccccacttagaattagggtttccaaactcatcacaaactctca |
130 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||| |||||||| | || ||| || ||||| ||||||||||| || | |||||||||| ||||||| |
|
|
| T |
28604451 |
aatcatggtttgataaccaacaaaaagttcgaaatgccataggcttatcgaacgaaacccacatagaattagggcttgcctactcatcacatactctca |
28604353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University