View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1069_high_12 (Length: 425)
Name: NF1069_high_12
Description: NF1069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1069_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 6e-41; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 104 - 193
Target Start/End: Original strand, 31412855 - 31412944
Alignment:
| Q |
104 |
aggcttcaaactatgcaaacatttctctgttataggctttaaactatgcaatcgtagaagcaaaatgaaaatgggtttggagatggagaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31412855 |
aggcttcaaactatgcaaacatttctctgttataggcttcaaactatgcaatcgtagaagcaaaatgaaaatgggtttggagatggagaa |
31412944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 273 - 323
Target Start/End: Original strand, 31413058 - 31413108
Alignment:
| Q |
273 |
ttttgttttgagaaagatttgatcatgtggagcaagatatcatattggttt |
323 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31413058 |
ttttgttttgagaaagatatgatcatgtggagcaagatatcatattggttt |
31413108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 176 - 214
Target Start/End: Original strand, 31412953 - 31412991
Alignment:
| Q |
176 |
gggtttggagatggagaagaggatgaaggagttatgttt |
214 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31412953 |
gggtttggagatggagaaagggatgaaggagttatgttt |
31412991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 43
Target Start/End: Original strand, 11877910 - 11877946
Alignment:
| Q |
7 |
tccaacaatatttcaagataagaaaaactcgaataat |
43 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11877910 |
tccaacaaaatttcaagataagaaaaactcgaataat |
11877946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 287 - 323
Target Start/End: Complemental strand, 2769822 - 2769786
Alignment:
| Q |
287 |
agatttgatcatgtggagcaagatatcatattggttt |
323 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
2769822 |
agatatgatcatgtggagcaagatatcttattggttt |
2769786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University