View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1069_high_19 (Length: 306)
Name: NF1069_high_19
Description: NF1069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1069_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 8e-61; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 38 - 188
Target Start/End: Complemental strand, 23701531 - 23701381
Alignment:
| Q |
38 |
atcaaaatttagtagatgatatctccctcttagtctttcatgatcatgatgaagaaatttttcaattatgtgatgagacatatgcagaagaattacaaat |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23701531 |
atcaaaatttagtagatgatatctccctcttagccctacatgatcatgatgaagaaatttttcgattatgtgatgagacatatgcagaagaattacaaat |
23701432 |
T |
 |
| Q |
138 |
acaagaagcattattattttccactcttggggcaaatactactatagatgt |
188 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||||||||| |
|
|
| T |
23701431 |
acaagaagcattattattttccgctcttatgtcaaatactactatagatgt |
23701381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 81 - 188
Target Start/End: Original strand, 23694327 - 23694434
Alignment:
| Q |
81 |
tcatgatgaagaaatttttcaattatgtgatgagacatatgcagaagaattacaaatacaagaagcattattattttccactcttggggcaaatactact |
180 |
Q |
| |
|
||||||| |||||||||||| | ||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
23694327 |
tcatgataaagaaatttttcgaatatctgaagagacatatgcagaggaattacaaatacaagaagcattattattttccactcttatgtcaaatactact |
23694426 |
T |
 |
| Q |
181 |
atagatgt |
188 |
Q |
| |
|
|||||||| |
|
|
| T |
23694427 |
atagatgt |
23694434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 252 - 299
Target Start/End: Complemental strand, 23701323 - 23701276
Alignment:
| Q |
252 |
ggcttttgtaggtgaatattctttgtcgccgtcttattcttcatctca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23701323 |
ggcttttgtaggtgaatattctttgtcgccgtcttattcttcttctca |
23701276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University