View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1069_low_27 (Length: 281)
Name: NF1069_low_27
Description: NF1069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1069_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 22 - 246
Target Start/End: Complemental strand, 42080937 - 42080713
Alignment:
| Q |
22 |
catcatcaaatgaatcctgtgagagtgtgagcatatcgttcgtctcgaaatctgattccattgagaatcgcgttatctaatacacgatttcgctgaaacg |
121 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42080937 |
catcatcaaatgaatcttgtgagagtgtgagcatatcgttcgtctcgaaatctgattccattgagaatcgcgttatctaatacacgatttcgctgaaacg |
42080838 |
T |
|
| Q |
122 |
aattctatcgattcgaagaacggcaaagtaatttaggaaccaaaattgtttatcgttattcaatttgtgaaactggaagggttttgatgaaaccgaggca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42080837 |
aattctatcgattcgaagaacggcaaagtaatttaggaaccaaaattgtttatagttattcaatttgtgaaactggaagggttttgatgaaaccgaggca |
42080738 |
T |
|
| Q |
222 |
cggaaattcgaagaccaaaacaagc |
246 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42080737 |
cggaaattcgaagaccaaaacaagc |
42080713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University