View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1069_low_29 (Length: 272)
Name: NF1069_low_29
Description: NF1069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1069_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 243
Target Start/End: Original strand, 31789704 - 31789935
Alignment:
| Q |
13 |
gtgagatgaacagaaatgacgcaagtaacacagtgaccaaagtagagcaactatcctttctgtttacctcgaatggtttttaggtaatgttggaccacac |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789704 |
gtgatatgaacagaaatgacgcaagtaacacagtgaccaaagtagagcaactatcctttctgtttacctcgaatggtttttaggtaatgttggaccacac |
31789803 |
T |
|
| Q |
113 |
ctatattgaggagcttcaatgg-gnnnnnnnngggttgcattgcagctttttgattagtttataactttgatcatgtggctcctactccaaggaagtcaa |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789804 |
ctatattgaggagcttcaatggaaaaaaaaaagggttgcattgcagctttttgattagtttataactttgatcatgtggctcctactccaaggaagtcaa |
31789903 |
T |
|
| Q |
212 |
taaatggaattgcatctgaaggagggggatta |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31789904 |
taaatggaattgcatctgaaggagggggatta |
31789935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University