View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1069_low_30 (Length: 257)
Name: NF1069_low_30
Description: NF1069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1069_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 190
Target Start/End: Complemental strand, 1361556 - 1361387
Alignment:
| Q |
22 |
gttggtgtgtttattatggagtatgtttatgggataggatttggctatctattggt-ataaaactacaattgatttttccgtctccattaattgtttgta |
120 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1361556 |
gttggtttgtttattatggagtatgtttatgggataggatttggctatctattggttataaaactacaattgatttttccgtctccattaattgtttgta |
1361457 |
T |
|
| Q |
121 |
ttaaaagtacatttgtgcttgctatttccttgctaactttgatgcggacaaaaaagagtcgaaatgaaag |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1361456 |
ttaaaagtacatttgtgcttgctatttcctagctaactttgatgcgaacaaaaaagagtcgaaatgaaag |
1361387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 189 - 222
Target Start/End: Complemental strand, 1361309 - 1361276
Alignment:
| Q |
189 |
agaggataatcaggttcaaatctatggttaaaat |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
1361309 |
agagcataatcaggttcaaatctatggttaaaat |
1361276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University