View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10700_low_13 (Length: 272)
Name: NF10700_low_13
Description: NF10700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10700_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 159
Target Start/End: Complemental strand, 21967199 - 21967058
Alignment:
| Q |
18 |
aataagatatgagaccaaccagcatgtaattaataataagctacttcatctatgcaaatgtatgcaatgttttaactcaaaaggatttgtgaaggtatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21967199 |
aataagatatgagaccaaccagcatgtgattaataataagctacttcatctatgcaaatgtatgcaatgttttaactcaaaaggatttgtgaaggtatca |
21967100 |
T |
|
| Q |
118 |
gatatacaacatattgtatatactagagcaaatgtataacaa |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21967099 |
gatatacaacatattgtatatactagagcaaatgtataacaa |
21967058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 256
Target Start/End: Complemental strand, 21966993 - 21966961
Alignment:
| Q |
224 |
cctccaattctattgtttagttaaaagtgtatc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21966993 |
cctccaattctattgtttagttaaaagtgtatc |
21966961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University