View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10700_low_18 (Length: 219)
Name: NF10700_low_18
Description: NF10700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10700_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 45095346 - 45095565
Alignment:
| Q |
1 |
gtcatacacgtgaagtgtcacttttgccatcttcaacaaaaattagagtgagattcttaaactctatctatgtatctggggtttgaatcagagttagatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45095346 |
gtcatacacgtgaagtgtcacttttgccatcttcaacaaaaattagagtgagattcttaaactctatctatgtatctggggtttgaatcagagttagatt |
45095445 |
T |
 |
| Q |
101 |
ctgctgaaagaatccttgaacttaatttctatccctgccattgtcaaaagtg-aaaatcttcttgaatttgtatttgagagggaacacataaaactgtgg |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45095446 |
cttctgaaagaatccttgaacttaatttctatccctgccattatcaaaagtgaaaaatcttcttgaatttgtatttgagagggaacacataaaactgtgg |
45095545 |
T |
 |
| Q |
200 |
catcaactttggcgctgatc |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45095546 |
catcaactttggcgctgatc |
45095565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University