View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10701_high_1 (Length: 518)
Name: NF10701_high_1
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10701_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 24 - 311
Target Start/End: Original strand, 56314943 - 56315227
Alignment:
| Q |
24 |
tgtaaaagttattggcaaaggtattagttgtacggtaattagccgaggtaatggacactcttatcttatctcaaaaacctatcgcaatttatcaaaggaa |
123 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
56314943 |
tgtaaaagttattagcagaggtattagttgtacggtaattagccatggtaacggacactcttatcttatctcaaaaatctatcgcaatttatcaaaggaa |
56315042 |
T |
 |
| Q |
124 |
tgttcttgttgcataatgctttagtggtgaatgaagtggtggatttggcaaggnnnnnnnngatggagtgtttgatcatgaacgtagattttcaaaaagc |
223 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
56315043 |
tgttcttgttgcatagtgctttagtggtgaatgaagtggtggatttggcaaggaaaaaaaagatggagtgtttgatcatgaa---agattttcaaaaagc |
56315139 |
T |
 |
| Q |
224 |
ctatgactcaattagttggaggttattgccctatatgttacggtggttcgggtttagtgatagatggtgtggttggatgaagacatgc |
311 |
Q |
| |
|
|||||| || ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56315140 |
ctatgattcgattagttggaggttattgcactatatgttacggtggttcgggtttagtgatagatggtgtggttggatgaagacatgc |
56315227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 322 - 503
Target Start/End: Original strand, 56315252 - 56315433
Alignment:
| Q |
322 |
atagtttctcggctttggttaatgggtgtctcgcgatacaaatgaacattaagaaggatttgaagcacgaagatcctttagctcatttttagtggcggag |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56315252 |
atagtttctcggctttggttaatgggtgtctcgcgattcaaatgaacattaagaaggatttgaagcacgaagatcctttagctcatttttagtggcggag |
56315351 |
T |
 |
| Q |
422 |
ggtttaggtctttgatgaagaaggcggtgtctttaggcttcttcaaagggtttatgcttccaaactcgaagagggtggtgtt |
503 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
56315352 |
ggtttaggtttttgatgaagaaggcggtgtctttaggcttcttcaaagggtttatgcttccaaactcgaagaagatggtgtt |
56315433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University