View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10701_high_5 (Length: 303)
Name: NF10701_high_5
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10701_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 6 - 288
Target Start/End: Original strand, 12550206 - 12550488
Alignment:
| Q |
6 |
aggaggaaacactgtgttggcgtctgagaaatctgaatgaaaaaggtgtgattaaggttaaccctacaatgaagacaacattgatggattgggagcaggt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550206 |
aggaggaaacactgtgttggcgtctgagaaatctgaatgaaaaaggtgtgattaaggttaaccctacaatgaagacaacattgatggattgggagcaggt |
12550305 |
T |
|
| Q |
106 |
ggagactgcttaatgcttgagagaattatcaatgatgcagaggttggttggtaataacaatgtatccgatgcatgcaaataaaaagaaaatgacaaaagt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12550306 |
ggagactgcttaatgcttgagagaattatcaatgatgcagaggttggttggtaataacaatgtattcgatgcatgcaaataaaaagaaaatgacaaaagt |
12550405 |
T |
|
| Q |
206 |
tgtgacaccattgatgagaaaacaagcaactcagaatttctttttaaatctttatttaccaaatctttgaatattaaggttgg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550406 |
tgtgacaccattgatgagaaaacaagcaactcagaatttctttttaaatctttatttaccaaatctttgaatattaaggttgg |
12550488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University