View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10701_high_6 (Length: 250)

Name: NF10701_high_6
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10701_high_6
NF10701_high_6
[»] chr4 (1 HSPs)
chr4 (15-250)||(33424965-33425200)


Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 250
Target Start/End: Complemental strand, 33425200 - 33424965
Alignment:
15 ggggatattagagggatatactttttaaaatattttgaaaaaataggtcctatcaataaccagcgtattcagctctcttataaattgagttttctctttc 114  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||    
33425200 ggggatattagtgggatatactttttaaaatattttgaaaaaataggtcctatcaataatcagcgtattcagctcccttataaattgagttttctctttc 33425101  T
115 ttttaagaaagaagaggatctcaattcgttttttgcacatactactattagtcatggcaggtgatcgtgagcatgagatgagtgaattcagttttgaaca 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
33425100 ttttaagaaagaagaggatctcaattcgttttttgcacatactactattagtcatggcaggtgatcgtgagcatgagatgagtgaattcagttttgaata 33425001  T
215 gcgctcattttgtccatgataaatgcatttaagacc 250  Q
    ||||||||||||||||||||||||||||||||||||    
33425000 gcgctcattttgtccatgataaatgcatttaagacc 33424965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University