View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10701_high_6 (Length: 250)
Name: NF10701_high_6
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10701_high_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 250
Target Start/End: Complemental strand, 33425200 - 33424965
Alignment:
| Q |
15 |
ggggatattagagggatatactttttaaaatattttgaaaaaataggtcctatcaataaccagcgtattcagctctcttataaattgagttttctctttc |
114 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33425200 |
ggggatattagtgggatatactttttaaaatattttgaaaaaataggtcctatcaataatcagcgtattcagctcccttataaattgagttttctctttc |
33425101 |
T |
|
| Q |
115 |
ttttaagaaagaagaggatctcaattcgttttttgcacatactactattagtcatggcaggtgatcgtgagcatgagatgagtgaattcagttttgaaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33425100 |
ttttaagaaagaagaggatctcaattcgttttttgcacatactactattagtcatggcaggtgatcgtgagcatgagatgagtgaattcagttttgaata |
33425001 |
T |
|
| Q |
215 |
gcgctcattttgtccatgataaatgcatttaagacc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33425000 |
gcgctcattttgtccatgataaatgcatttaagacc |
33424965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University